Skip to main content

Table 2 Oligonucleotide primers used in PCR and direct sequencing

From: Comparative evaluation of three immunochromatographic identification tests for culture confirmation of Mycobacterium tuberculosis complex

Target gene Primer ID Nucleotide sequence (5'-3') Size (bp) Ref. no.
MTC identification     
 16S rRNA 285 GAGAGTTTGATCCTGGCTCAG 1028 7
  264 TGCACACAGGCCACAAGGGA   
  259 TTTCACGAACAACG GACAA 591  
cfp32 Rv0577F ATGCCCAAGAGAAGCGAATACAGGCAA 786 14
  Rv0577R CTATTGCTGCGGTGCGGGCTTCAA   
 RD9 Rv2073cF TCGCCGCTGCCAGATGAGTC 600 14
  Rv2073cR TTTGGGAGCCGCCGGTGGTGATGA   
 RD12 Rv3120F GTCGGCGATAGACCATGAGTCCGTCTCCAT 404 14
  Rv3120R GCGAAAAGTGGGCGGATGCCAG   
 RD1 ET1 AAGCGGTTGCCGCCGACCGACC   15
  ET2 CTGGCTATATTCCTGGGCCCGG   
  ET3 GAGGCGATCTGGCGGTTTGGGG   
 RD4 Rv1510F GTGCGCTCCACCCAAATAGTTGC 1033 15
  Rv1510R TGTCGACCTGGGGCACAAATCAGTC   
 RD7 Rv1970F GCGCAGCTGCCGGATGTCAAC 1116 15
  Rv1970R CGCCGGCAGCCTCACGAAATG   
 MiD3 IS1561F GCTGGGTGGGCCCTGGAATACGTGAACTCT 530 15
  IS1561R AACTGCTCACCCTGGCCACCACCATGGACT   
Distinguish sub-strains of BCG    
 RD2 RD2l CCAGATTCAAATGTCCGACC   16
  RD2r GTGTCATAGGTGATTGGCTT   
 RD14 RD14l CAGGGTTGAAGGAATGCGTGTC   16
  RD14r CTGGTACACCTGGGGAATCTGG   
 RD15 RD8l ACTCCTAGCTTTGCTGTGCGCT   16
  RD8r GTACTGCGGGATTTGCAGGTTC   
 RD16 RD16nf ACATTGGGAAATCGCTGCTGTTG   17
  RD16nr GGCTGGTGTTTCGTCACTTC   
SenX3-RegX3 C3 GCGCGAGAGCCCGAACTGC   16
  C5 GCGCAGCAGAAACGTCAGC   
Sequencing     
mpt64 (Rv1980c) mpb64W-F ACTCAGATATCGCGGCAATC 1061 this study
  mpb64W-R CGATCACCTCACCTGGAGTT   
 Rv1977 Rv1977F GTTTCCCGAGATCAGCTCAA 348 this study
  Rv1977R ATCTCGTCGTGTGTCACCAG   
 Rv1981c Rv1981F GATCGAATGCAGGCTGGTAT 399 this study
  Rv1981R ACTACTACCGCGGTGACGAC