Skip to main content

Table 1 Primer and probe sequences employed for PRNP analysis

From: Analysis of multiple single nucleotide polymorphisms closely positioned in the ovine PRNPgene using linear fluorescent probes and melting curve analysis

Primer/Probe Sequence (5'-3')
136F2 forward primer GCAGCTGGAGCAGTGGTAGG
171R2 reverse primer GATGTTGACACAGTCATGCAC
136A2 probe GGGAAGFGCCAFGAGCAGGC3
154H2 probe GACCGFTACTAFCATGAAAACATG3
171R6 probe CAGTGGAFCGGTAFAGTAAC5AGAA3
141C3 probe GAGCAGGCCTCTFATAC5FTTTGG3
  1. F and 3 represent fluorescein dT and 3' phosphate respectively. Common SNPs within codons 136, 141, 154 and 171 are underlined. 5 represents the universal base 5-nitroindol employed to neutralise polymorphisms within codons 143 and 175.