Skip to main content

Table 4 Predicted Tms of rare PRNP polymorphisms

From: Analysis of multiple single nucleotide polymorphisms closely positioned in the ovine PRNPgene using linear fluorescent probes and melting curve analysis

Probe Polymorphisms Oligonucleotide sequence (5'-3') Mean Tm SD
136A2 A136 GCCTGCTCATGGCACTTCCC 61.6°C 0.13
136A2 V136 GCCTGCTCATGACACTTCCC 53.3°C 0.13
136A2 A136 & S138R GCCTGCGCATGGCACTTCCC 57.3°C 0
136A2 V136 & S138R GCCTGCGCATGACACTTCCC 47.3°C 0.13
136A2 A136 & S138N GCCTGTTCATGGCACTTCCC 55.9°C 0.13
136A2 V136 & S138N GCCTGTTCATGACACTTCCC 44.9°C 0.18
154H2 H154 CATGTTTTCATGATAGTAACGGTC 57.2°C 0.18
154H2 R154 CATGTTTTCACGATAGTAACGGTC 50.2°C 0.18
154H2 H154 & R151C CATGTTTTCATGATAGTAACAGTC 51.4°C 0
154H2 R154 & R151C CATGTTTTCACGATAGTAACAGTC 43.1°C 0
154H2 H154 & R151H CATGTTTTCATGATAGTAATGGTC 52.7°C 0.13
154H2 R154 & R151H CATGTTTTCACGATAGTAATGGTC 45.2°C 0.13
154H2 H154 & R151G CATGTTTTCATGATAGTAACCGTC 51.1°C 0
154H2 R154 & R151G CATGTTTTCACGATAGTAACCGTC 42.8°C 0
154H2 R154L CATGTTTTCAAGATAGTAACGGTC 52.2°C 0.18
171R6 R171 TTCTGGTTACTATACCGATCCACTG 56.9°C 0
171R6 Q171 TTCTGGTTACTATACTGATCCACTG 50.5°C 0.27
171R6 H171 TTCTGGTTACTATAATGATCCACTG 45.2°C 0.18
171R6 R171 & Y172D TTCTGGTTACTATCCCGATCCACTG 50.5°C 0.28
171R6 Q171 & Y172D TTCTGGTTACTATCCTGATCCACTG 46.3°C 0.13
171R6 H171 & Y172D TTCTGGTTACTATCATGATCCACTG 40.7°C 0.13
141C3 L141 CCAAAATGTATAAGAGGCCTGCTC 54.1°C 0.17
141C3 F141 CCAAAATGTATAAAAGGCCTGCTC 45.1°C 0.13
141C3 L141 & S138N CCAAAATGTATAAGAGGCCTGTTC 49.4°C 0.13
141C3 F141 & S138N CCAAAATGTATAAAAGGCCTGTTC 39.2°C 0.17
141C3 L141 & H143R CCAAAACGTATAAGAGGCCTGCTC 54.9°C 0.13
141C3 F141 & H143R CCAAAACGTATAAAAGGCCTGCTC 45.6°C 0.13
  1. Complementary oligonucleotides were employed to predict the affect of rare polymorphisms on probe melting temperature. Six replicate analyses were performed for each target oligonucleotide. The mean Tm and standard deviation (SD) for melting peaks is presented. The nucleotides representing the polymorphisms in codons 136, 141, 154 and 171 are highlighted along with rare polymorphisms in neighbouring codons.