Skip to main content

Table 1 Primer sequence, primer concentration and predicted length of PCR products for multiplex PCR used to identify ETEC, EPEC, EHEC, EIEC and EAEC

From: Identification of diarrheagenic Escherichia coli isolated from infants and children in Dar es Salaam, Tanzania

Assay Target gene Oligonucleotide sequence (5' to 3') Ampl Size (bp) Reff
  elt F. CTCTATGTGCACACGGAGC 322 12
   R. CCATACTGATTGCCGCAAT   
Assay n1 St1a F.TCTTTCCCCTCTTTTAGTCAGTC 170 11
   R. CCGCACAGGCAGGATTAC   
  uidA F. CCAAAAGCCAGACAGAGT 623 11
   R. GCACAGCACATCAAAGAG   
  eae F. TGATAAGCTGCAGTCGAATCC 229 11
Assay n2   R. CTGAACCAGATCGTAACGGC   
  bfpA F. CACCGTTACCGCAGGTGTGA 450 11
   R. GTTGCCGCTTCAGCAGGAGT   
  stx 1 F. GAAGAGTCCGTGGGATTACG 130 11
   R. AGCGATGCAGCTATTAATAA   
Assay n3 Stx 2 F.GGGTACTGTGTGCCTGTTACTGG 510 11
   R. GCTCTGGATGCATCTCTGGT   
  ial F.CTGGTAGGTATGGTGAGG 320 11
   R. CCAGGCCAACAATTATTTCC   
  St1b F.ATTTTTCTTTCTGTATTGTCTT 190 15
Assay n4   R.CACCCGGTACAAGCAGGATT   
  uidA F. CCAAAAGCCAGACAGAGT 623 11
   R. GCACAGCACATCAAAGAG   
  aggR F. CTAATTGTACAATCGATGTA 457 12
Assay n5   R. AGAGTCCATCTCTTTGATAAG   
  Aat F. CTGGCGAAAGACTGTATCAT 629 12
   R. CAATGTATAGAAATCCGCTGTT   
  1. F. forward primers, R. reverse primers.