Skip to main content

Table 1 Primers used for the detection of β-lactamase-encoding genes

From: High prevalence and characterization of extended-spectrum ß-lactamase producing Enterobacteriaceae in Chadian hospitals

PCR ß-lactamase genes Primers Nucleotide sequences Amplicon size (bp)
Multiplex I TEM including TEM-1 and TEM-2 MultiTSO-T_for
MultiTSO-T_rev
CATTTCCGTGTCGCCCTTATTC
CGTTCATCCATAGTTGCCTGAC
800
SHV including SHV-1 MultiTSO-S_for
MultiTSO-S_rev
AGCCGCTTGAGCAAATTAAAC
ATCCCGCAGATAAATCACCAC
713
OXA-1, OXA-4 and OXA-30 MultiTSO-O_for
MultiTSO-O_re
GGCACCAGATTCAACTTTCAAG
GACCCCAAGTTTCCTGTAAGTG
564
Multiplex II CTX-M-1, CTX-M-3 and CTX-M-15 MultiCTXMGp1_for
MultiCTXMGp1-2_rev
TTAGGAARTGTGCCGCTGYA
CGATATCGTTGGTGGTRCCAT
688
CTX-M-2 MultiCTXMGp2_for
MultiCTXMGp1-2_re
CGTTAACGGCACGATGAC
CGATATCGTTGGTGGTRCCAT
404
CTX-M-9 and CTX-M14 MultiCTXMGp9_for
MultiCTXMGp9_rev
TCAAGCCTGCCGATCTGGT
TGATTCTCGCCGCTGAAG
561
CTX-M-8/25 CTX-M-8/25 CTX-Mg8/25_for
CTX-Mg8/25_re
AACRCRCAGACGCTCTAC
TCGAGCCGGAASGTGTYAT
326