Skip to main content

Table 1 Primers and probes used for duplex real-time PCR

From: Pathogen analysis of pertussis-like syndrome in children

Target genePrimerSequence (5′ to 3′)
ptxA-PrPTp1CCAACGCGCATGCGTGCAGATTCGTC
ptxA-PrPTp2CCCTCTGCGTTTTGATGGTGCCTATTTTA
IS481BP-1GATTCAATAGGTTGTATGCATGGTT
IS481BP-2MODTGGACCATTTCGAGTCGACG