Skip to main content

Table 2 Primer sequences of the target genes

From: Determining the susceptibility of carbapenem resistant Klebsiella pneumoniae and Escherichia coli strains against common disinfectants at a tertiary hospital in China

GenePrimer Sequence(5′ → 3′)Size (bp)Reference
qacEΔ1F: TAGCGAGGGCTTTACTAAGC300[12]
R: ATTCAGAATGCCGAACACCG  
qacA/BF: CTATGGCAATAGGAGATATGGTGT416[3]
R: CCACTACAGATTCTTCAGCTACATG  
cepAF: CAACTCCTTCGCCTATCCCG1051[12]
R: TCAGGTCAGACCAAACGGCG