Table 1 Summary of NoV primers used
From: Fast detection of Noroviruses using a real-time PCR assay and automated sample preparation
Real-time PCR (polymerase gene) | |||
|---|---|---|---|
Primer | Location | Oligonucleotide sequence (5' - 3') | Reference |
NV p110a | 4865 - 4883 | ACDATYTCATCATCACCATA | 18 |
NV p36a | 4487 - 4505 | ATAAAAGTTGGCATGAACA | 15 |
NV NIb | 4495 - 4515 | GAATTCCATCGCCCACTGGCT | 17 |
Nested PCR (polymerase gene) | |||
Primer | Location | Oligonucleotide sequence (5' - 3') | Reference |
Primer 32b | 4226 - 4245 | ATGAATATGAATGAAGATGG | 23 |
Primer 36a | 4980 - 4961 | ATTGGTCCTTCTGTTTTGTC | 23 |
Primer 35a | 4890 - 4871 | GTTGACACAATCTCATCATC | 23 |
Primer 33b | 4280 - 4299 | TACCACTATGATGCAGATTA | 23 |