Skip to main content

Table 1 Primers sequences and annealing temperature for nested PCR of MSP2

From: Severe oxidative stress in sickle cell disease patients with uncomplicated Plasmodium falciparum malaria in Kampala, Uganda

PCR round Primer name. Primer Sequence.(5′ → 3′) Annealing temp (°C) Positive Control Allelic Family
Primary 1 ATGAAGGTAATTAAAACATTGTCTATTATA 55   
4 ATATGGCAAAAGATAAAACAAGTGTTGCTG 55   
Secondary A1 GCAGAAAGTAAGCCTTCTACTGGTGCT 55 3D7 IC3D7
A2 GATTTGTTTCGGCATTATTATGA 55
B1 GCAAATGAAGGTTCTAATACTAATAG 55 HB3 FC27
B1 GCTTTGGGTCCTTCTTCAGTTGATTC 55
  1. PCR Polymerase chain reaction, MSP2 Merozoite surface protein 2